| 
 | 
nospace | 
% nospace Remove all whitespace from an ASCII text file ASCII text file: seqspace.txt ASCII text output file [seqspace.nospace]:  | 
Go to the input files for this example
Go to the output files for this example
   Standard (Mandatory) qualifiers:
  [-infile]            infile     ASCII text file
  [-outfile]           outfile    [*.nospace] ASCII text output file
   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:
   "-outfile" associated qualifiers
   -odirectory2        string     Output directory
   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
 | 
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-infile] (Parameter 1)  | 
ASCII text file | Input file | Required | 
| [-outfile] (Parameter 2)  | 
ASCII text output file | Output file | <*>.nospace | 
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
>X13776 ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt cctcgag  | 
>X13776 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacggga actgcacgatctacctggcgagcctggagcacgagcgggttcgcttcgta cggcgctgagcgacagtcacaggagaggaaacggatgggatcgcaccagg agcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaa ccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgc aaccggggggtacggttcctcgtgggctgctacatgtcgcacacgcgcaa ggcggtgatgccggtggtcgagcgcgccgacgcgctgctctgctacccga ccccctacgagggcttcgagtattcgccgaacatcgtctacggcggtccg gcgccgaaccagaacagtgcgccgctggcggcgtacctgattcgccacta cggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctc gaggaaatctacattccgctgtatccctccgacgacgacttgcagcgcgc cgtcgagcgcatctaccaggcgcgcgccgacgtggtcttctccaccgtgg tgggcaccggcaccgccgagctgtatcgcgccatcgcccgtcgctacggc gacggcaggcggccgccgatcgccagcctgaccaccagcgaggcggaggt ggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgcctt acttctccagcatcgatacgcccgccagccgggccttcgtccaggcctgc catggtttcttcccggagaacgcgaccatcaccgcctgggccgaggcggc ctactggcagaccttgttgctcggccgcgccgcgcaggccgcaggcaact ggcgggtggaagacgtgcagcggcacctgtacgacatcgacatcgacgcg ccacaggggccggtccgggtggagcgccagaacaaccacagccgcctgtc ttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggc agtcgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctc gacgactggtccgccagcatgggcgggggaccgctcccatgagcgccaac tcgctgctcggcagcctgcgcgagttgcaggtgctggtcctcaacccgcc gggggaggtcagcgacgccctggtcttgcagctgatccgcatcggttgtt cggtgcgccagtgctggccgccgccggaagccttcgacgtgccggtggac gtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgc gctgctcgccgccgggactccgcgcactaccctggtggcgctggtggagt acgaaagccccgcggtgctctcgcagatcatcgagctggagtgccacggc gtgatcacccagccgctcgatgcccaccgggtgctgcctgtgctggtatc ggcgcggcgcatcagcgaggaaatggcgaagctgaagcagaagaccgagc agctccaggaccgcatcgccggccaggcccggatcaaccaggccaaggtg ttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacct gtcgcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcagg agttgctgggaaacgagccgtccgcctgagcgatccgggccgaccagaac aataacaagaggggtatcgtcatcatgctgggactggttctgctgtacgt tggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgc gtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccg ccaaccagttcctcgag  | 
| Program name | Description | 
|---|---|
| aligncopy | Reads and writes alignments | 
| aligncopypair | Reads and writes pairs from alignments | 
| biosed | Replace or delete sequence sections | 
| codcopy | Copy and reformat a codon usage table | 
| cutseq | Removes a section from a sequence | 
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences | 
| descseq | Alter the name or description of a sequence | 
| entret | Retrieves sequence entries from flatfile databases and files | 
| extractalign | Extract regions from a sequence alignment | 
| extractfeat | Extract features from sequence(s) | 
| extractseq | Extract regions from a sequence | 
| featcopy | Reads and writes a feature table | 
| featreport | Reads and writes a feature table | 
| listor | Write a list file of the logical OR of two sets of sequences | 
| makenucseq | Create random nucleotide sequences | 
| makeprotseq | Create random protein sequences | 
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N | 
| maskambigprot | Masks all ambiguity characters in protein sequences with X | 
| maskfeat | Write a sequence with masked features | 
| maskseq | Write a sequence with masked regions | 
| newseq | Create a sequence file from a typed-in sequence | 
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file | 
| noreturn | Remove carriage return from ASCII files | 
| notab | Replace tabs with spaces in an ASCII text file | 
| notseq | Write to file a subset of an input stream of sequences | 
| nthseq | Write to file a single sequence from an input stream of sequences | 
| pasteseq | Insert one sequence into another | 
| revseq | Reverse and complement a nucleotide sequence | 
| seqret | Reads and writes (returns) sequences | 
| seqretsplit | Reads sequences and writes them to individual files | 
| sizeseq | Sort sequences by size | 
| skipredundant | Remove redundant sequences from an input set | 
| skipseq | Reads and writes (returns) sequences, skipping first few | 
| splitter | Split sequence(s) into smaller sequences | 
| trimest | Remove poly-A tails from nucleotide sequences | 
| trimseq | Remove unwanted characters from start and end of sequence(s) | 
| trimspace | Remove extra whitespace from an ASCII text file | 
| union | Concatenate multiple sequences into a single sequence | 
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) | 
| yank | Add a sequence reference (a full USA) to a list file |