![]() |
featreport |
% featreport Reads and writes a feature table Input sequence: paamir.fasta Input features: paamir.gff Output report [x13776.featreport]: test.out |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers: [-sequence] sequence Sequence filename and optional format, or reference (input USA) [-features] features (no help text) features value [-outfile] report [*.featreport] Output report file name Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of the sequence to be used -send1 integer End of the sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-features" associated qualifiers -fformat2 string Features format -fopenfile2 string Features file name -fask2 boolean Prompt for begin/end/reverse -fbegin2 integer Start of the features to be used -fend2 integer End of the features to be used -freverse2 boolean Reverse (if DNA) "-outfile" associated qualifiers -rformat3 string Report format -rname3 string Base file name -rextension3 string File name extension -rdirectory3 string Output directory -raccshow3 boolean Show accession number in the report -rdesshow3 boolean Show description in the report -rscoreshow3 boolean Show the score in the report -rstrandshow3 boolean Show the nucleotide strand in the report -rusashow3 boolean Show the full USA in the report -rmaxall3 integer Maximum total hits to report -rmaxseq3 integer Maximum hits to report for one sequence General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages |
Standard (Mandatory) qualifiers | Allowed values | Default | |
---|---|---|---|
[-sequence] (Parameter 1) |
Sequence filename and optional format, or reference (input USA) | Readable sequence | Required |
[-features] (Parameter 2) |
(no help text) features value | Readable feature table | Required |
[-outfile] (Parameter 3) |
Output report file name | Report output file | <*>.featreport |
Additional (Optional) qualifiers | Allowed values | Default | |
(none) | |||
Advanced (Unprompted) qualifiers | Allowed values | Default | |
(none) |
>X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgat ctacctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcac aggagaggaaacggatgggatcgcaccaggagcggccgctgatcggcctgctgttctccg aaaccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcg agcaactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccgggggg tacggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcg agcgcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccga acatcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctga ttcgccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatct acattccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccagg cgcgcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcg ccatcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcg aggcggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgcctt acttctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttct tcccggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgc tcggccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgt acgacatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccaca gccgcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggc agtcgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggt ccgccagcatgggcgggggaccgctcccatgagcgccaactcgctgctcggcagcctgcg cgagttgcaggtgctggtcctcaacccgccgggggaggtcagcgacgccctggtcttgca gctgatccgcatcggttgttcggtgcgccagtgctggccgccgccggaagccttcgacgt gccggtggacgtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgc gctgctcgccgccgggactccgcgcactaccctggtggcgctggtggagtacgaaagccc cgcggtgctctcgcagatcatcgagctggagtgccacggcgtgatcacccagccgctcga tgcccaccgggtgctgcctgtgctggtatcggcgcggcgcatcagcgaggaaatggcgaa gctgaagcagaagaccgagcagctccaggaccgcatcgccggccaggcccggatcaacca ggccaaggtgttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacct gtcgcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcaggagttgctggg aaacgagccgtccgcctgagcgatccgggccgaccagaacaataacaagaggggtatcgt catcatgctgggactggttctgctgtacgttggcgcggtgctgtttctcaatgccgtctg gttgctgggcaagatcagcggtcgggaggtggcggtgatcaacttcctggtcggcgtgct gagcgcctgcgtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccgccaaccagtt cctcgag |
##gff-version 2.0 ##date 2003-02-14 ##Type DNA PAAMIR PAAMIR EMBL source 1 2167 0.000 + . Sequence "PAAMIR.1" ; db_xref "taxon:287" ; organism "Pseudomonas aeruginosa" ; strain "PAC" ; isolate "PAC 1" ; map "38 min" PAAMIR EMBL CDS 1289 1879 0.000 + . Sequence "PAAMIR.2" ; db_xref "SWISS-PROT:P10932" ; note "aliphatic amidase regulator, positive regulator of amiE" ; transl_table 11 ; gene "amiR" ; protein_id "CAA32023.1" ; translation "MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA" PAAMIR EMBL CDS 135 1292 0.000 + . Sequence "PAAMIR.3" ; db_xref "SWISS-PROT:P27017" ; note "negative regulator of amiR" ; transl_table 11 ; gene "amiC" ; protein_id "CAA32024.1" ; translation "MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP" PAAMIR EMBL promoter 8 24 0.000 + . Sequence "PAAMIR.4" ; note "proposed rpoN-dependent promoter" PAAMIR EMBL promoter 65 81 0.000 + . Sequence "PAAMIR.5" ; note "proposed rpoN-dependent promoter" PAAMIR EMBL RBS 121 126 0.000 + . Sequence "PAAMIR.6" ; note "proposed Shine-Dalgarno sequence" PAAMIR EMBL variation 912 1167 0.000 + . Sequence "PAAMIR.7" ; note "ClaI fragment deleted in pSW36, constitutive phenotype" ; replace "" ; gene "amiC" PAAMIR EMBL misc_feature 1 1 0.000 + . Sequence "PAAMIR.8" ; FeatFlags "0x40" ; note "last base of an XhoI site" PAAMIR EMBL misc_feature 648 653 0.000 + . Sequence "PAAMIR.9" ; note "end of 658bp XhoI fragment, deletion in pSW3 causes constitutive expression of amiE" PAAMIR EMBL conflict 1281 1281 0.000 + . Sequence "PAAMIR.10" ; FeatFlags "0x40" ; replace "g" ; citation [3] |
##gff-version 3 ##sequence-region PAAMIR 1 2167 #!Date 2008-07-15 #!Type DNA #!Source-version EMBOSS 6.0.0 PAAMIR EMBL databank_entry 1 2167 0.000 + . ID="PAAMIR.1";db_xref="taxon:287";organism="Pseudomonas aeruginosa";strain="PAC";isolate="PAC 1";map="38 min" PAAMIR EMBL CDS 1289 1879 0.000 + 0 ID="PAAMIR.2";db_xref="SWISS-PROT:P10932";note="aliphatic amidase regulator, positive regulator of amiE";transl_table=11;gene="amiR";protein_id="CAA32023.1";translation="MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA" PAAMIR EMBL CDS 135 1292 0.000 + 0 ID="PAAMIR.3";db_xref="SWISS-PROT:P27017";note="negative regulator of amiR";transl_table=11;gene="amiC";protein_id="CAA32024.1";translation="MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP" PAAMIR EMBL promoter 8 24 0.000 + . ID="PAAMIR.4";note="proposed rpoN-dependent promoter" PAAMIR EMBL promoter 65 81 0.000 + . ID="PAAMIR.5";note="proposed rpoN-dependent promoter" PAAMIR EMBL ribosome_entry_site 121 126 0.000 + . ID="PAAMIR.6";note="proposed Shine-Dalgarno sequence" PAAMIR EMBL sequence_variant 912 1167 0.000 + . ID="PAAMIR.7";note="ClaI fragment deleted in pSW36, constitutive phenotype";replace="";gene="amiC" PAAMIR EMBL located_sequence_feature 1 1 0.000 + . ID="PAAMIR.8";featflags="0x40";note="last base of an XhoI site" PAAMIR EMBL located_sequence_feature 648 653 0.000 + . ID="PAAMIR.9";note="end of 658bp XhoI fragment, deletion in pSW3 causes constitutive expression of amiE" PAAMIR EMBL sequence_conflict 1281 1281 0.000 + . ID="PAAMIR.10";featflags="0x40";replace="g";citation=[3] |
Program name | Description |
---|---|
aligncopy | Reads and writes alignments |
aligncopypair | Reads and writes pairs from alignments |
biosed | Replace or delete sequence sections |
codcopy | Copy and reformat a codon usage table |
cutseq | Removes a section from a sequence |
degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
descseq | Alter the name or description of a sequence |
entret | Retrieves sequence entries from flatfile databases and files |
extractalign | Extract regions from a sequence alignment |
extractfeat | Extract features from sequence(s) |
extractseq | Extract regions from a sequence |
featcopy | Reads and writes a feature table |
listor | Write a list file of the logical OR of two sets of sequences |
makenucseq | Create random nucleotide sequences |
makeprotseq | Create random protein sequences |
maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
maskambigprot | Masks all ambiguity characters in protein sequences with X |
maskfeat | Write a sequence with masked features |
maskseq | Write a sequence with masked regions |
newseq | Create a sequence file from a typed-in sequence |
nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
noreturn | Remove carriage return from ASCII files |
nospace | Remove all whitespace from an ASCII text file |
notab | Replace tabs with spaces in an ASCII text file |
notseq | Write to file a subset of an input stream of sequences |
nthseq | Write to file a single sequence from an input stream of sequences |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a nucleotide sequence |
seqret | Reads and writes (returns) sequences |
seqretsplit | Reads sequences and writes them to individual files |
sizeseq | Sort sequences by size |
skipredundant | Remove redundant sequences from an input set |
skipseq | Reads and writes (returns) sequences, skipping first few |
splitter | Split sequence(s) into smaller sequences |
trimest | Remove poly-A tails from nucleotide sequences |
trimseq | Remove unwanted characters from start and end of sequence(s) |
trimspace | Remove extra whitespace from an ASCII text file |
union | Concatenate multiple sequences into a single sequence |
vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
yank | Add a sequence reference (a full USA) to a list file |